View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4078_low_4 (Length: 204)
Name: NF4078_low_4
Description: NF4078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4078_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 28250390 - 28250219
Alignment:
| Q |
18 |
acatactcagagcgatcactccaggagctagttcgaaaccactccggtgatggaatcgggtcatcagattacaatgattcagacatcagatcaaaacaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250390 |
acatactcagagcgatcactccaggagctagttcgaaaccactccggtgatggaatcgggtcatcagattacaatgattcagacatcagatcaaaacaac |
28250291 |
T |
|
| Q |
118 |
gaagccttctacagttaattatcaatctcttcccttcagagaaagcagcttttccaatcaacttcctttgct |
189 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28250290 |
gaagccttctagagttaattatcaatctcttcccttcggagaaagcagcttttccaatcaacttcctttgct |
28250219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University