View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4079_low_6 (Length: 243)
Name: NF4079_low_6
Description: NF4079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4079_low_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 6274747 - 6274523
Alignment:
| Q |
19 |
tcataagtgataataacactcaaaatactgctcaaataaactaaaacgagtgaactttgctttatttctgggattagtctaaagactaacctatttatct |
118 |
Q |
| |
|
|||||||||| ||||| ||||||||||| ||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6274747 |
tcataagtgacaataaaactcaaaatacagctcaaataaactaaaatgagtgaaattttctttatttctgggattagtctaaagaccaacctatttatct |
6274648 |
T |
 |
| Q |
119 |
ctcttaatccaacagctctgcagcatgtggcatcactcttgaaatcggtctatttcgaagcagcactaatcgctgcatatcgagatttgaaaaagccgag |
218 |
Q |
| |
|
||||||||||||| ||||| |||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6274647 |
ctcttaatccaacggctctcgagcatgcggcatcactcctgaaatcagtctatttcgaagcagcactaatcgctgcatatcgagatttgaaaaagccgag |
6274548 |
T |
 |
| Q |
219 |
gagtccatcttttggagggagattc |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6274547 |
gagtccatcttttggagggagattc |
6274523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University