View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4081_high_29 (Length: 292)
Name: NF4081_high_29
Description: NF4081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4081_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 51 - 290
Target Start/End: Original strand, 36687040 - 36687281
Alignment:
| Q |
51 |
ttaaatgattaggttatttaatcgatgtgcatcgacgatataagnnnnnnn-agtgaagcataatatcaaatcacacgatcatatatttccaaatatcta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36687040 |
ttaaatgattaggttatttaatcgatgtgcatcgacgatataagttttttttagtgaagcaaaatatcaaatcacacgatcatatatttccaaatatcta |
36687139 |
T |
 |
| Q |
150 |
tatggtgagatttgattgggtttaccagtattcgaattttataatgacagattgataataagatgaaattatgga-nnnnnnnngttgttgattaagatg |
248 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36687140 |
tatggtgagatgttattgggtttaccagtattcgaattttataatgacagattgataataagatgaaattatggatttttttttgttgttgattaagatg |
36687239 |
T |
 |
| Q |
249 |
ctaagctagagaacatagttattgatcttcacctttgcttct |
290 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
36687240 |
ttaagctagagaacatagttattggtcttcaccattgtttct |
36687281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University