View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4081_high_37 (Length: 237)
Name: NF4081_high_37
Description: NF4081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4081_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 7542033 - 7541815
Alignment:
| Q |
1 |
ataagcttgacaatggcaattggtataagattttgtgtgtccattaagaattagcattatgtaacaatataataa---agcatgcacatgagagttttat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7542033 |
ataagcttgacaatggcaattggtataagattttgtgtgtccattaagaattagcattatgtaacaatataataattaagcatgcacatgagagttttat |
7541934 |
T |
 |
| Q |
98 |
ataactaatttatttggacatcaatgtacgtattagtgatttatttgtcggattgattttggatcatcttgattttgtaaactttatattaataaagagt |
197 |
Q |
| |
|
||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7541933 |
atacctaatt-atttggacatcaatgtataacttagtgatttatttgtcggattgattttggatcatcttgatattgtaaactttatattaataaagagt |
7541835 |
T |
 |
| Q |
198 |
aaaagagtaaactaatgtcc |
217 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7541834 |
aaaagagtaaactaatgtcc |
7541815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University