View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4081_low_10 (Length: 447)
Name: NF4081_low_10
Description: NF4081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4081_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 6e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 141 - 430
Target Start/End: Original strand, 26191199 - 26191478
Alignment:
| Q |
141 |
cttagccatcttttcatgacatgaaaggccaattcatgtttgtgaatgtgatgcggatgtgttactttcttttcttttttagtattgtaagttaggcaca |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26191199 |
cttagccatcttttcatgacatgaaaggccaattcatgtttgggaatgtg-----------ttcctttcttttcttttttagtattgtaagttaggcaca |
26191287 |
T |
 |
| Q |
241 |
ctttt-ttatccaaacatgtttcttaatttccctaaaataatgtcatggtcaattttgttatgtgcaacgannnnnnnnnnnnnnnnnnnnnnnngttaa |
339 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
26191288 |
ctttttttatccaaacatgtttcttaatttccctaaaataatgtcatggtcaattttgttatgtgcaaccattttttcttctctttttcttttttgttaa |
26191387 |
T |
 |
| Q |
340 |
accatgtattttcctaagaaaaacatgtttgtttcttgaatattccagttgcctttttgtggaacttcagtggatttaataaattaatctg |
430 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26191388 |
accatgtattttcctaagaaaaacatgtctgtttcttgaataatccagttgcctttttgtggaacttcagtggatttaataaattaatctg |
26191478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 26191073 - 26191150
Alignment:
| Q |
1 |
ttgtgagataagattattgtcgagcatcgcatgcgaa----tctctctacaaatttctgtctaggggaatatatcaaa |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26191073 |
ttgtgagataagattattgtcgagcatcgcatgtgaatctctctctctacaaatttctgtctaggggaatatatcaaa |
26191150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University