View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4081_low_21 (Length: 337)
Name: NF4081_low_21
Description: NF4081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4081_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 176 - 323
Target Start/End: Original strand, 28527124 - 28527271
Alignment:
| Q |
176 |
tctcatgaaggcatatttgtattacagaagtttaatgactatgcaaattgatggtgtaaagtaattttacactgttatccaatagaacccatcatcttgt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28527124 |
tctcatgaaggcatatttgtattacagaagtttaatgactatgcaaattgatggtgtaaagtaattttacactgttatccaatagaacccatcatcttgt |
28527223 |
T |
|
| Q |
276 |
catgtaaggcatattttatcatactttgtctccctctcatgtgcatca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28527224 |
catgtaaggcatattttatcatactttgtctccctctcatgtgcatca |
28527271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University