View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4081_low_25 (Length: 325)
Name: NF4081_low_25
Description: NF4081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4081_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 11 - 312
Target Start/End: Original strand, 38225406 - 38225707
Alignment:
| Q |
11 |
cagagattatccaagtattaaagagaatggtctttgaagtctcttcaagtactttattggtggaaagatgtaaaatcaaggaaagaatgccaatgacgaa |
110 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225406 |
cagagattatacaagtattaaagagaatggtctttgaagtctctttaagtactttattggtggaaagatgtaaaatcaaggaaagaatgccaatgacgaa |
38225505 |
T |
 |
| Q |
111 |
gagactttcttgacttaagatatctgcctcttttgatggaatagagtactccatcatctgcagaagtggtacgtgctgttagaactacaaaaattattga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225506 |
gagactttcttgacttaagatatctgcctcttttgatggaatagagtactccatcatctgcagaagtggtacgtgctgttagaactacaaaaattattga |
38225605 |
T |
 |
| Q |
211 |
ccgaatctccaaattttctagtaagattccctatgcttgctatggaattattgtggatatattgcagcatcagaacacaatatttgcattccacttcttc |
310 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38225606 |
ccgaatctccaaattttctagtgagattccctatgcttgctatggaattattgtggatatattgcagcatcagaacacaatatttgcattccacttcatc |
38225705 |
T |
 |
| Q |
311 |
tc |
312 |
Q |
| |
|
|| |
|
|
| T |
38225706 |
tc |
38225707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University