View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4081_low_43 (Length: 229)
Name: NF4081_low_43
Description: NF4081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4081_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 8577543 - 8577762
Alignment:
| Q |
1 |
agctggaatgatctctccaaaactcttattgttctcaaatttgtgcttctcacttatttatactacaacttatctaggttaagctccattgttaat---- |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8577543 |
agctggaatgatctctccaaaactcttattgttctcaaatgtgtgcttctcacttatttatactacaactcatctaggttaagctccattgttaattaaa |
8577642 |
T |
 |
| Q |
97 |
tgaggaaaattctaaattttgtatagtaggtggaat-----gnnnnnnntaatggttgtacaatcctgcagagtttgttacaactaaagaggtgttgcca |
191 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8577643 |
tgaggaaaattccaaattttgtatagtaggtggaatgaaaagaaaaaaaaaatggttgtacaatcctgcagagtttgttacaactaaagaggtgtggcca |
8577742 |
T |
 |
| Q |
192 |
tgtggttactgcttttcctt |
211 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8577743 |
tgtggttactgcttttcctt |
8577762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 211
Target Start/End: Complemental strand, 8597415 - 8597358
Alignment:
| Q |
154 |
atcctgcagagtttgttacaactaaagaggtgttgccatgtggttactgcttttcctt |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
8597415 |
atcctgcagagtttgttacaacgaaagaggtgtggccatgtggttactgctttgcctt |
8597358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 61
Target Start/End: Complemental strand, 8597451 - 8597414
Alignment:
| Q |
24 |
tcttattgttctcaaatttgtgcttctcacttatttat |
61 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
8597451 |
tcttaatgttctcaaatgtgtgcttctcacttatttat |
8597414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University