View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4082_high_21 (Length: 360)
Name: NF4082_high_21
Description: NF4082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4082_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 16 - 351
Target Start/End: Complemental strand, 19214075 - 19213740
Alignment:
| Q |
16 |
gtattggctattttggaggaaattggggaggttttgtagaggattttggaaattgattcctgggtgattataaaaaaggaaactttttgaggtagaagaa |
115 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19214075 |
gtattggttattttggaggaaattggggaggttttgtagaggattttggaaattgattcctgggtgattataaaaaagggaactttttgaggtagaagaa |
19213976 |
T |
 |
| Q |
116 |
tgttaaagagtgattggtgttgtttgtatttgcagggctaatgatatatgtagggagtcaaagaggcagattatcaatgctgaagatgtgttcaaagctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19213975 |
tgttaaagagtgattggtgttgtttgtatttgcagggctaatgatatatgtagggagtcaaagaggcagattatcaatgctgaagatgtgttcaaagctc |
19213876 |
T |
 |
| Q |
216 |
ttgaagaaaccgagtttgctgagtttgttggccctctaaaagattctcttgaaggtcactttcactttcctatgatatgagtttacggagtttttcagat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19213875 |
ttgaagaaaccgagtttgctgagtttgttggccctctaaaagattctcttgaaggtcactttcactttcctatgatatgagtttacggagtttttcagat |
19213776 |
T |
 |
| Q |
316 |
tagctgtgatttatttttacctgttgttagtataat |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19213775 |
tagctgtgatttatttttacctgttgttagtttaat |
19213740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University