View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4082_high_47 (Length: 223)
Name: NF4082_high_47
Description: NF4082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4082_high_47 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 88 - 223
Target Start/End: Original strand, 52037174 - 52037305
Alignment:
| Q |
88 |
gttatgtaggaaatggagtgtcatagtagacaactcggttgataaattgaatgagtactaatcaaagaannnnnnnnnnnnnngaaggaagtactaatca |
187 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52037174 |
gttatgtaggaaatggagtctcatagtagacaactcggttgataaattgaatgagtactaatcaaaga----ttttttttttttaaggaagtactaatca |
52037269 |
T |
|
| Q |
188 |
aagatataaagttcaaaataataaccttaacataat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52037270 |
aagatataaagttcaaaataataaccttaacataat |
52037305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University