View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4082_low_34 (Length: 292)
Name: NF4082_low_34
Description: NF4082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4082_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 12 - 279
Target Start/End: Complemental strand, 3311146 - 3310877
Alignment:
| Q |
12 |
aagcaaaggagcatttaagagtagtgtctctttcttgacctctcacacacgccacacacaacatgtacaaaaggctgctccatgtccaagcctcatattt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311146 |
aagcaaaggagcatttaagagtagtgtctctttcttgacctctcacacacgccacacacaacatgtacaaaaggctgctccatgtccaagcctcatattt |
3311047 |
T |
|
| Q |
112 |
gtcatttatgaagatatttttacagttgaaaaccctctcactcagacctagtttatagttcaatctgcaaaagcagcagcactcatttctcctctctatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3311046 |
gtcatttatgaagatatttttacagttgaaaaccctctcactcagacctagtttatagtgcaatctgcaaaagcagcaacactcatttctcctctctatc |
3310947 |
T |
|
| Q |
212 |
ctcacatatcaatcatcag--tttaacgagatctgatgacatgccctatccacgtgttgcatgtctttct |
279 |
Q |
| |
|
||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310946 |
ctcacatatcagttatcagtttttaacgagatctgatgacatgccctatccacgtgttgcatgtctttct |
3310877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University