View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4082_low_35 (Length: 283)
Name: NF4082_low_35
Description: NF4082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4082_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 58 - 275
Target Start/End: Complemental strand, 37136018 - 37135801
Alignment:
| Q |
58 |
ggtacaaaattatttattaaaaatgttagagcgataagaaactcaattgatgctcaaaaggtaaaattgaaaacacaactttctctctttatgtttataa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136018 |
ggtacaaaattatttattaaaaatgttagagcgaaaagaaactcaattgatgctcaaagggtaaaattgaaaacacaactttctctctttatgtttataa |
37135919 |
T |
 |
| Q |
158 |
caacaaaaagtatacaatctttaatattttaacttttatacgattgaataaagttggaataacagaaacgtaaatgaagtttccttcctttccccttgtt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135918 |
caacaaaaagtatacaatctttaatattttaacttttatacgattgaataaagttggaataacagaaacgtaaatgaagtttccttcctttccccttgtt |
37135819 |
T |
 |
| Q |
258 |
tcatgccacaggttctgc |
275 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
37135818 |
tcatgctacaggttctgc |
37135801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University