View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4082_low_41 (Length: 247)
Name: NF4082_low_41
Description: NF4082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4082_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 27842076 - 27841854
Alignment:
| Q |
18 |
aaagtccgtcatggaaagggagcaagtgtttgaattgttacctgctaaagagaatgaagcagtaatggag---------cttttccaatgaattttcttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27842076 |
aaagtccgtcatggaaagggagcaagtgtttgaattgttacctgctaaagagactgaagcagtaatggaggcaatggagcttttccaatgaattttcttg |
27841977 |
T |
 |
| Q |
109 |
ttattgaatctgaattgattccttgcaaaccagattgaatttatgatgttgatgatagcagcattcaccactagcttggattggtgattggaagatctgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27841976 |
ttattgaatctgaattgattccttgcaaaccagatggaatttatgatgttgatgatagcagcattcaccactagcttggattggtgattggaatatctgt |
27841877 |
T |
 |
| Q |
209 |
tacttgggtaccaaatgtcttca |
231 |
Q |
| |
|
|||| | |||||||||||||||| |
|
|
| T |
27841876 |
tactcgtgtaccaaatgtcttca |
27841854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 88 - 166
Target Start/End: Complemental strand, 13138137 - 13138059
Alignment:
| Q |
88 |
cttttccaatgaattttcttgttattgaatctgaattgattccttgcaaaccagattgaatttatgatgttgatgatag |
166 |
Q |
| |
|
||||| ||||||||||||||||| | ||||| | |||||| ||||||||||| | ||| || ||||||||||| |||| |
|
|
| T |
13138137 |
ctttttcaatgaattttcttgtttctaaatctcatttgatttcttgcaaaccaaactgagttgatgatgttgatcatag |
13138059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University