View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4082_low_46 (Length: 238)
Name: NF4082_low_46
Description: NF4082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4082_low_46 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 26839506 - 26839727
Alignment:
| Q |
17 |
aaatgtaaatagttaaatgcaattttccagtnnnnnnngatagtgtaagttagaaaatcatacttcacgaggattagcttccctaagcatatcaatgaga |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26839506 |
aaatttaaatagttaaatgcaattttccagtaaaaaaagatagtgtaagttagaaaatcatacttcacgaggattagcttccctaagcatatcaatgaga |
26839605 |
T |
|
| Q |
117 |
tgatcaattgcaacagtcttcttaaaaacttcttcggcttcttgattggctgcacatatcaaagttttcctgtttttagatccaaacacgcaatttcatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26839606 |
tgatcaattgcaacagtcttcttaaaagcttcttcggcttcttgattggctgcacatatcaaagttttcctgtttttagatccaaacacgcaatttcatt |
26839705 |
T |
|
| Q |
217 |
caaatctactatttcagatagc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26839706 |
caaatctactatttcagatagc |
26839727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 205
Target Start/End: Original strand, 46499526 - 46499575
Alignment:
| Q |
156 |
tcttgattggctgcacatatcaaagttttcctgtttttagatccaaacac |
205 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
46499526 |
tcttgattggctgcacacatcaaagttctcctgtttttagattcaaacac |
46499575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University