View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4083_low_11 (Length: 205)
Name: NF4083_low_11
Description: NF4083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4083_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 37809260 - 37809090
Alignment:
| Q |
19 |
atgttgattatttattcaggtacatggaaccattgatttccagtgtccctgtaatggtagtagaagggaatcatgagatagaagaacaagctgaaaacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809260 |
atgttgattatttattcaggtacatggaaccattgatttccagtgtcccggtaatggtagtagaagggaatcatgagatagaagaacaagctgaaaacaa |
37809161 |
T |
|
| Q |
119 |
gacattcgttgcttatagttctcgatttgcatttccgtcggaagagagtggatcatcttcaactttatatt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37809160 |
gacattcgttgcttatagttctcgatttgcatttccgtcggaagagagtgggtcatcttcaactttatatt |
37809090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 25 - 189
Target Start/End: Complemental strand, 37816668 - 37816504
Alignment:
| Q |
25 |
attatttattcaggtacatggaaccattgatttccagtgtccctgtaatggtagtagaagggaatcatgagatagaagaacaagctgaaaacaagacatt |
124 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| | |||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37816668 |
attattgattcaggtacatggaacctctgattgctagtgtcccaataatggtagtggaagggaatcatgagatagaagaacaagctgaaaacaagacatt |
37816569 |
T |
|
| Q |
125 |
cgttgcttatagttctcgatttgcatttccgtcggaagagagtggatcatcttcaactttatatt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||| |||| |
|
|
| T |
37816568 |
cgttgcttatagttctcgatttgcatttccgtcagaagagagtggatcatcatccactttctatt |
37816504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University