View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4084_low_1 (Length: 404)
Name: NF4084_low_1
Description: NF4084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4084_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 155 - 364
Target Start/End: Complemental strand, 4614704 - 4614495
Alignment:
| Q |
155 |
cataatcttacacattgtttcagtaaatctgaatctgtgtttgtgtgttgaagccatgaatgaagaacaaaaatctctgcttctagaatcttcttctcgc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614704 |
cataatcttacacattgtttcagtaaatctgaatctgtgtttgtgtgttgaagccatgaatgaagaacaaaaatctctgcttctagaatcttcttctcgc |
4614605 |
T |
|
| Q |
255 |
ttcttactctcacaaggttcttcgcaatttcacttttgtatattccaactaacaaaacgatgtcgttttcgttgtctgattctgttattgctgttaatac |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614604 |
ttcttactctcacaaggttcttcgcaatttcacttttgtatattccaactaacaaaacgatgtcgttttcgttgtctgattctgttattgctgttaatac |
4614505 |
T |
|
| Q |
355 |
ggttgagttt |
364 |
Q |
| |
|
|||||||||| |
|
|
| T |
4614504 |
ggttgagttt |
4614495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 25 - 125
Target Start/End: Complemental strand, 4614837 - 4614737
Alignment:
| Q |
25 |
tctctaggttttataactttatctatttcatttcaatttacgattatataatagtgtaactcttcgattatatcgtcaaatgacgtttttgccctttctt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614837 |
tctctaggttttataactttatctatttcatttcaatttacgattatataatagtgtaactcttcgattatatcgtcaaatgacgtttttgccctttctt |
4614738 |
T |
|
| Q |
125 |
c |
125 |
Q |
| |
|
| |
|
|
| T |
4614737 |
c |
4614737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University