View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4084_low_5 (Length: 243)

Name: NF4084_low_5
Description: NF4084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4084_low_5
NF4084_low_5
[»] chr5 (1 HSPs)
chr5 (19-243)||(32523415-32523636)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 32523636 - 32523415
Alignment:
19 gtggtagctgcgaacggttgggagaactcgttcttttgtgcactagctagggttttggattttagggcttttctcttattggtttatggtgtatcactaa 118  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32523636 gtggtagctgcgaacggttgggagaactcactcttttgtgcactagctagggttttggattttagggcttttctcttattggtttatggtgtatcactaa 32523537  T
119 tccggtctcttgtaattttcttttgacataatctattgaatagaaattcaccgatgaataaatggaaaatttagagtttgaacttctttttccgcatact 218  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||   ||||| |||||||||    
32523536 tccggtctcttgtaattttcttttgacataatctattgattagaaattcaccgatgaataaatggaaaattcagagtttgaa---cttttcccgcatact 32523440  T
219 aaaatttctatgccaattgagttgc 243  Q
     ||||||||||||||||||||||||    
32523439 taaatttctatgccaattgagttgc 32523415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University