View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4084_low_5 (Length: 243)
Name: NF4084_low_5
Description: NF4084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4084_low_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 32523636 - 32523415
Alignment:
| Q |
19 |
gtggtagctgcgaacggttgggagaactcgttcttttgtgcactagctagggttttggattttagggcttttctcttattggtttatggtgtatcactaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523636 |
gtggtagctgcgaacggttgggagaactcactcttttgtgcactagctagggttttggattttagggcttttctcttattggtttatggtgtatcactaa |
32523537 |
T |
 |
| Q |
119 |
tccggtctcttgtaattttcttttgacataatctattgaatagaaattcaccgatgaataaatggaaaatttagagtttgaacttctttttccgcatact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
32523536 |
tccggtctcttgtaattttcttttgacataatctattgattagaaattcaccgatgaataaatggaaaattcagagtttgaa---cttttcccgcatact |
32523440 |
T |
 |
| Q |
219 |
aaaatttctatgccaattgagttgc |
243 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32523439 |
taaatttctatgccaattgagttgc |
32523415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University