View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4085_low_14 (Length: 261)
Name: NF4085_low_14
Description: NF4085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4085_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 23 - 246
Target Start/End: Complemental strand, 7475014 - 7474791
Alignment:
| Q |
23 |
tgacaacatggcagccccgccgcaaggtctccctcttcagacggcggaaggttcaaacggtgaggctaggcagcaagaaaccacgacggagaataattgg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7475014 |
tgacaacatggcagccccgccgcaaggtctccctcttcagacggcggaaggttcaaacggtgaggctaggcagcaagaaaccacgacggagaataattgg |
7474915 |
T |
|
| Q |
123 |
tggcatagttagaatgtttaaaaggatgcgtgtaaagtggcttaagttacaatatcttaggttattaaaacggcttaaggaacattatagaaacgttgtg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474914 |
tggcatagttagaatgtttaaaaggatgcgtgtaaagtggcttaagttacaatatcttaggttgttaaaacggcttaaggaacattatagaaacgttgtg |
7474815 |
T |
|
| Q |
223 |
aaagatcttattgaagctggtgct |
246 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
7474814 |
aaagatctcattgaagctggtgct |
7474791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University