View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4085_low_15 (Length: 237)
Name: NF4085_low_15
Description: NF4085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4085_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 26438556 - 26438778
Alignment:
| Q |
1 |
tttgaaaatttgtgaaaagctacactcaagttatttgatgatagatccaaatgttccagatttttcatatcaaacattgagtttggaatattaccatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26438556 |
tttgaaaatttgtgaaaagctacactcaagttatttgatgataggtccaataataccagatttttcatatcaaacattgagtttggaatattaccatgta |
26438655 |
T |
 |
| Q |
101 |
gcctagtataagacagatcaacatgtgtcaaagaataagcagagaattcaccaattgacccagtaaactggtttccaccaagatataactttgataatga |
200 |
Q |
| |
|
||||| ||| ||| |||||||| | |||||||||||||||||||||||||||||| | ||| |||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
26438656 |
gcctattatgagaaagatcaacttctgtcaaagaataagcagagaattcaccaatgggccctgtaaactggtttccactgagatataactctaataatga |
26438755 |
T |
 |
| Q |
201 |
tgacaaagaataacaccattgtg |
223 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
26438756 |
tgataaagaataacaccattgtg |
26438778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University