View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4085_low_17 (Length: 226)
Name: NF4085_low_17
Description: NF4085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4085_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 40467006 - 40466800
Alignment:
| Q |
15 |
tatatatctttcatctagttgatatctcactagcaactcacacttgaacttcaacacggttgatttcttgtgtttaacttacacatgttgaagattaact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40467006 |
tatatatctttcatctagttgatatctcactagcaactcacacttgaacttcaacacggttgatttcttgtgtttaacttacacatgttgaagattaact |
40466907 |
T |
|
| Q |
115 |
atctaaagagcaaacaattacatcttcattaaaacctaaaaatattgagcatatagatcacttttcttgtatatcttttaataaacgctcacgacattca |
214 |
Q |
| |
|
||| |||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40466906 |
atcgaaagagcaaacaatcatatcttcattaaaacctaaaaatattgagcatataaatcacttttcttgtatatcttttaataaatactcacgacattca |
40466807 |
T |
|
| Q |
215 |
tctcact |
221 |
Q |
| |
|
| ||||| |
|
|
| T |
40466806 |
tttcact |
40466800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University