View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4085_low_6 (Length: 403)
Name: NF4085_low_6
Description: NF4085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4085_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Complemental strand, 38663503 - 38663114
Alignment:
| Q |
1 |
caagaactgtgacataaccgaaccgtccccagtctctcgcgaccaaccacaaactcccgactctaccaccactctagccacccaactctcactctatctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38663503 |
caagaactgtgacataaccgaaccgtccccagtctctcgcgaccaaccacaaactcccgactctaccaccactctagccacccaactctcactctatctc |
38663404 |
T |
 |
| Q |
101 |
actacgattttgatgagtgaacactctttgttgaataatcccccattcaagaattttttggacctgtgacaattctaccaattgtctctgtcgccagaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38663403 |
actacgattttgatgagtgaacactctttgttgaataatcccccattcaagaattttttggacctgtgacaattctaccaactgtctctgtcgccagaga |
38663304 |
T |
 |
| Q |
201 |
ccccttgccttccaagaatcgcagccgtgcttcggattgggagttcttgaacccaccgggtgtaggagattatggagattatgtggattggcgttccact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38663303 |
ccccttgccttccaagaatcgcagccgtgcttcggattgggagttcttgaacccaccgggtgtaggagattatggagattatgtggattggcgttccact |
38663204 |
T |
 |
| Q |
301 |
gtaaatgcttcaagagagtcgattacttttgctt---aagttgctggagaaggtctcaccgccggagaagggggtgtgtatcggagtttc |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38663203 |
gtaaatgcttcaagagagtcgattacttttgcttaagaagttgctggagaaggtctcaccgccggagaaggtggtgtgtatcggagtttc |
38663114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University