View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4086_high_13 (Length: 321)
Name: NF4086_high_13
Description: NF4086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4086_high_13 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 24 - 321
Target Start/End: Original strand, 31225392 - 31225689
Alignment:
| Q |
24 |
ccccgtgtatgtacttcaaatggtgttggaacccaagggagtgtcttttgcgaatggcttaagctgatccggtgctgttatgtgttgggtgatgcggtgt |
123 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31225392 |
ccccgtgtatgtacttcaaatggttttggaacccaagggagtgtcttttgcgaatggcttaagctgatccggtgctgttatgtgttgggtgatgcggtgt |
31225491 |
T |
|
| Q |
124 |
tctgcagtttttctggtgtcgggtttctgtcggttgttggtgttcgctgctgagtttttgggggctattttgtgggttcaaacaacacttgttgtttttt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31225492 |
tctgcagtttttttggtgtcgggtttctgtcggttgttggtgttcgctgctgagtttttgggggctattttgtgggttcaaacaacacttgctgtttttt |
31225591 |
T |
|
| Q |
224 |
cctgtgcagctgctgtgttgcattagcaaggcctgttgtgttggnnnnnnnncttttctgttttggctaggcctagggagcctcttgggttctgtgct |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31225592 |
cctgtgcagctgctgtgttgcattagcaaggcctgttgtgttggttttttttcttttctgttttggctaggcctagggagccccttgggttctgtgct |
31225689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 26 - 75
Target Start/End: Original strand, 35400865 - 35400914
Alignment:
| Q |
26 |
ccgtgtatgtacttcaaatggtgttggaacccaagggagtgtcttttgcg |
75 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||||||||| ||||||| |
|
|
| T |
35400865 |
ccgtgtatgtattacgaatggtgttggaacccaagggagtgtattttgcg |
35400914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 82 - 222
Target Start/End: Complemental strand, 41310408 - 41310269
Alignment:
| Q |
82 |
ttaagctgatccggtgctgttatgtgttgggtgatgcggtgttctgcagtttttctggtgtcgggtttctgtcggttgttggtgttcgctgctgagtttt |
181 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| |||||||| ||||||||| | || || ||| ||||||| ||| ||| ||||| |||||||||||| |
|
|
| T |
41310408 |
ttaagttgctccggtgctgtcctgtgttgggtgctgcggtgtactgcagtttctttgctgccggtattctgtcagtt-ttgctgttctctgctgagtttt |
41310310 |
T |
|
| Q |
182 |
tgggggctattttgtgggttcaaacaacacttgttgttttt |
222 |
Q |
| |
|
|||||||| |||| ||||||||||| ||| || ||||||| |
|
|
| T |
41310309 |
tgggggctcctttgcgggttcaaacagcacctgctgttttt |
41310269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University