View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4086_high_27 (Length: 248)
Name: NF4086_high_27
Description: NF4086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4086_high_27 |
 | |
|
| [»] scaffold0121 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0121 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 27834 - 28071
Alignment:
| Q |
1 |
ctctccttgataccttggatagcccgaacaacctcttccttaactccaccgttcttttcttccttgagtttcaagaaactcacacgaaaagcagtcccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27834 |
ctctccttgataccttggatagcccgaaaaacctcctccttaacttcaccgttcttttcgtccttgagtttcaagaaactcacacgaaaagcagtccccg |
27933 |
T |
|
| Q |
101 |
gtgaggggtgcgggggaagagttacttcccctgcaatccaatcgacgactaaaaggtcgtcaaggatagggagtgcgaagtttcttacgccgttgaggtg |
200 |
Q |
| |
|
|||| || ||||||||||||| |||||||| ||||||||||||| |||||| |||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27934 |
gtgaaggatgcgggggaagagcaacttcccccgcaatccaatcgatgactaagaggtcgtcgagaatagggagtgcgaagtttcttacgccgttgaggtg |
28033 |
T |
|
| Q |
201 |
ggtagggtgagcgttgtatatttgaagatcctcctttg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28034 |
ggtagggtgagcgttgtatatttgaagatcctcctttg |
28071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University