View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4086_high_29 (Length: 241)
Name: NF4086_high_29
Description: NF4086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4086_high_29 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 337361 - 337139
Alignment:
| Q |
19 |
cacagaagagaatgcatttactatcgtgcctttgattgacaatttaacattaccaattcataggacaacaaggaaaacaaaattgttcagtaaaatgttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||| |
|
|
| T |
337361 |
cacagaagagaatgcatttactatcgtgcctttgattgacaatttaacattaccaattcataggacaacaaagaaaactagtttgttcagtaaaatgttt |
337262 |
T |
 |
| Q |
119 |
agatatgaatcactcattacagcacatcaaaagcaaatgtagaaatgaaatactagtgtccatacatgcagatccagttaacatatattattagagtaga |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
337261 |
agatatgaatcactcactacagcacatcaaaagcaaatgtagaaatgaaatactagtgtccatacatgcagatccagttaacatatattattagagtaga |
337162 |
T |
 |
| Q |
219 |
tcagaattcagaagggatacctt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
337161 |
tcagaattcagaagggatacctt |
337139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University