View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4086_high_37 (Length: 222)
Name: NF4086_high_37
Description: NF4086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4086_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 26306849 - 26307041
Alignment:
| Q |
15 |
cacagacgccgaacacaacaatgacatattgacatggaaagacatgaatgtaacattaacatgtgtcgatgtcgtgttggtaggcactaccatatcattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
26306849 |
cacagacgccgaacacaacaatgacatattgacatggaaagacatgaatgcaacattaacatgtgtcgatgtcgcgttggtaggcactaccatatcatgt |
26306948 |
T |
 |
| Q |
115 |
attatt---gaag--gcataacaaataacatcatgaacatgatgttacaaacatgaatttgctgtagcatgacacttatgattgaaggcgtat |
202 |
Q |
| |
|
|||| | || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26306949 |
attagtaggctagtagcataacaaataacatcatgaacatgatgttataaacatgaatttgctgtagcatgacacttatgattgaaggcgtat |
26307041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University