View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4086_low_36 (Length: 235)
Name: NF4086_low_36
Description: NF4086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4086_low_36 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 9486009 - 9486229
Alignment:
| Q |
15 |
caacttacactttcaaagaagccatttggtaaaggctatatcaagtggtagtgaaattaattgatttggaggcggtgtttcaagtattgttatggtttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9486009 |
caacttacactttcaaagaagccatttggtaaaggctatatcaagtggtagtgaaattaattgatttggaggcggtgtttcaagtattgttatggtttat |
9486108 |
T |
 |
| Q |
115 |
agtattgttacaagtagtagtgaaataatttatcttttgcattggaatctgttgtgttttctactatactaatatggtttatagtattgttaatggcgag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9486109 |
agtattgttacaagtagtagtgaaataatctatcttttgcattggaatctgttgtgttttctactatactaatatggtttatagtattgttaatggcgag |
9486208 |
T |
 |
| Q |
215 |
tttatggcccatttaccttat |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9486209 |
tttatggcccatttaccttat |
9486229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University