View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4087_high_19 (Length: 239)
Name: NF4087_high_19
Description: NF4087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4087_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 28531227 - 28531449
Alignment:
| Q |
1 |
ctacctaattggataaattgtattataatcttatgatttctgatcttgtagagaacatgattggaaaaggtggtcatgcagaagtgtacaaaggacgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28531227 |
ctacctaattggataaattgtattataatcttatgatttctgatcttgtagagaacatgattggaaaaggtggtcatgcagaagtgtacaaaggacgctt |
28531326 |
T |
 |
| Q |
101 |
acctgatggaacggttgtagcagtaaagaggctaatgaacaatgagaaggaagctggagacagagctgctggtgatttcttgtcggagcttgggattatt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28531327 |
acctgatggaatggttgtagcagtaaagaggctaatgaacaatgagaaggaagctggagacagagctgctggtgatttcttgtcggagcttgggattatt |
28531426 |
T |
 |
| Q |
201 |
gctcacattaaccacccaaatgc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28531427 |
gctcacattaaccacccaaatgc |
28531449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 139
Target Start/End: Original strand, 13672680 - 13672770
Alignment:
| Q |
49 |
tagagaacatgattggaaaaggtggtcatgcagaagtgtacaaaggacgcttacctgatggaacggttgtagcagtaaagaggctaatgaa |
139 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| |||||||||| |||| | ||||| ||||| ||||||||||| |||||||| |
|
|
| T |
13672680 |
tagagaacttgattggaaaaggtggtcatgctgaagtatacaaaggacacttatcagatggtcaagttgtcgcagtaaagagactaatgaa |
13672770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 94
Target Start/End: Complemental strand, 40114799 - 40114763
Alignment:
| Q |
58 |
tgattggaaaaggtggtcatgcagaagtgtacaaagg |
94 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
40114799 |
tgattggaaaaggtggttatgctgaagtgtacaaagg |
40114763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University