View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4087_high_21 (Length: 236)
Name: NF4087_high_21
Description: NF4087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4087_high_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 40774647 - 40774427
Alignment:
| Q |
16 |
ctctcaaccctttagccaattttggatgaagtgtaggatcagtctcagaggttttgctgaagttgaaaattctgtcggtgaattctttgcagtgagtgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40774647 |
ctctcaaccctttagccaattttggatgaagtgtaggatcagtctcagaggttttgctgaagttgaaaattctgtcgctgaattctttgcagtgagtgaa |
40774548 |
T |
 |
| Q |
116 |
accaattgtgtgtgcaccggttaatgcaaccatttccttaatagtgaagttctttacggtaaatttgctaataatatcgtccattgtcatttttgttgtt |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40774547 |
accaattgtatgtgcaccggttaatgcaaccatttccttaatagtgaagttctttacggtaaatttgctaataatatcgtccattgtcatttttgttgtt |
40774448 |
T |
 |
| Q |
216 |
ggaagagctttttcagttctt |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40774447 |
ggaagagctttttcagttctt |
40774427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University