View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4088_high_16 (Length: 242)
Name: NF4088_high_16
Description: NF4088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4088_high_16 |
 | |
|
| [»] scaffold0025 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0025 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 231
Target Start/End: Complemental strand, 48795 - 48582
Alignment:
| Q |
19 |
acatttttgtcctcacagattattgaagagcacgcatggctccatattcccaacattgctatatccaaacttcattc-aataggcagcaatactctagaa |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
48795 |
acatgtttgtcctcacagattattgaagagcacgcatggctccatattcccaacattgctatatctaaacttcattccaataggcagcaatactctagaa |
48696 |
T |
|
| Q |
118 |
aaggggcaaggttggagggaaacgcacaagcatccactgtctctcgtatgtagctaaatatttccatccaatctcatcaagtaatgagagctttagctca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48695 |
aaggggcaaggttggagggaaacgcacaagcatccactgtctttcgtatgtagctaaatatttccatccaatctcatcaagtaatgagagctttagctca |
48596 |
T |
|
| Q |
218 |
tatagtttcttctt |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48595 |
tatagtttcttctt |
48582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 112 - 232
Target Start/End: Complemental strand, 45410049 - 45409929
Alignment:
| Q |
112 |
ctagaaaaggggcaaggttggagggaaacgcacaagcatccactgtctctcgtatgtagctaaatatttccatccaatctcatcaagtaatgagagcttt |
211 |
Q |
| |
|
|||||||||||| ||| | || || ||||| |||||||||||||||||||| ||||||||||||| ||||||||| || ||||| || ||||||||| |
|
|
| T |
45410049 |
ctagaaaaggggtaagctagggggaaaacgtacaagcatccactgtctctcatatgtagctaaatgagtccatccaacttcttcaagcaaagagagcttt |
45409950 |
T |
|
| Q |
212 |
agctcatatagtttcttcttc |
232 |
Q |
| |
|
|| | |||||||||||||||| |
|
|
| T |
45409949 |
agtttatatagtttcttcttc |
45409929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 168
Target Start/End: Original strand, 18038543 - 18038677
Alignment:
| Q |
35 |
agattattgaagagcacgcatggctccatattcccaa------cattgctatatccaaacttcatt-caataggcagcaatactctagaaaaggggcaag |
127 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||| |||||||||||| |||||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
18038543 |
agattattcaagagcac--atggctccatattcccaagtccaacattgctatatctaaacttcatttcaataggcc---ataca-tagaaaaggggcaag |
18038636 |
T |
|
| Q |
128 |
gttggagggaaacgcacaagcatccactgtctctcgtatgt |
168 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||| |
|
|
| T |
18038637 |
gttggagggaaatacacaagcattcactgtctctcatatgt |
18038677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University