View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4088_high_17 (Length: 240)
Name: NF4088_high_17
Description: NF4088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4088_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 6551988 - 6552209
Alignment:
| Q |
1 |
cttttgatagaacttgcaagcatcaagggagtgctatgatatcatattatgatattagagctgcccaaaatgcaatgagagcactcaataatagactctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6551988 |
cttttgatagaacttgcaagcatcaagggagtgctatgatatcatattatgatattagagctgcccaaaatgcaatgagagcactcaataatagactctt |
6552087 |
T |
 |
| Q |
101 |
cggccgcaagaaattcgacattcattatcctattccaaaggtcggatgccacatttttatttcctcattgaaacttagtcttaattattttttgtgtctg |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6552088 |
cggccgcaagaagttcgacattcattatcctattccaaaggtcggatgccacatttttatttcctcattgaaacttagtcttaatta--ttttgtgtctg |
6552185 |
T |
 |
| Q |
201 |
tatgaatcagttgtgattataact |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6552186 |
catgaatcagttgtgattataact |
6552209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 49060943 - 49060770
Alignment:
| Q |
1 |
cttttgatagaacttgcaagcatcaagggagtgctatgatatcatattatgatattagagctgcccaaaatgcaatgagagcactcaataatagactctt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||| | ||| |||||| |
|
|
| T |
49060943 |
cttttgatagagattgcaagcatcaagggaatgctatgatatcatattatgatatgagagctgcccaaaaagcaatgagagcactccagaatcaactctt |
49060844 |
T |
 |
| Q |
101 |
cggccgcaagaaattcgacattcattatcctattccaaaggtcggatgccacatttttatttcctcattgaaact |
175 |
Q |
| |
|
| || ||| |||||| |||||||||||| | || |||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
49060843 |
cagctgcaggaaatttgacattcattattcgataccaaaggttcgatgctgcatttttaatt-ctcattgaaact |
49060770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University