View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4088_low_7 (Length: 443)
Name: NF4088_low_7
Description: NF4088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4088_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 9e-77; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 105 - 282
Target Start/End: Original strand, 15560061 - 15560238
Alignment:
| Q |
105 |
catcatggatataatttaatcaatgtgtgatcatagtagaaatcccactagtaaagattataggagtgaacaaactgaaatcaactagttatgattaatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
15560061 |
catcatggatataatttaatcaatgtgtgatcatagtagaaatcccactagtaaagattataggagtgaacaaagtgaaatcaactacttatgattaatt |
15560160 |
T |
 |
| Q |
205 |
aagataaaatcttttttacaattagtcgagatatttgtgttacatcacatgtagcgcggatgtgctacgttgcgtggt |
282 |
Q |
| |
|
||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15560161 |
aagataaaatcttttttacaactagttaagatacccgtgttacatcacatgtagcgcggatgtgctacgttgcgtggt |
15560238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 15559993 - 15560063
Alignment:
| Q |
8 |
gaggagaagcaaaggtgaaaaagaaagagtacaagagtataaagccgggagaatatcctattcccacccat |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15559993 |
gaggagaagcaaaggtgaaaaagaaagagtacaagagtataaagccgggagaatatcctattcccacccat |
15560063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 292 - 332
Target Start/End: Original strand, 15560706 - 15560746
Alignment:
| Q |
292 |
gtgtgttatatacattgaagtttgatgggataatgatattc |
332 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15560706 |
gtgtgctatatacattgaagtttgatgggataatgatattc |
15560746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University