View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4090_low_2 (Length: 511)
Name: NF4090_low_2
Description: NF4090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4090_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 483; Significance: 0; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 483; E-Value: 0
Query Start/End: Original strand, 1 - 495
Target Start/End: Complemental strand, 37426073 - 37425579
Alignment:
| Q |
1 |
aatagtagatattgaaaaagcttgatatgagattcagaatcagagaatggtgttccggctgacgaagtgtgctgaaatccagcattctaaccgtgctttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37426073 |
aatagtagatattgaaaaagcttgatatgagattcagaatcagagaatggtgttccggctgacgaagtgtgctgaaatccagcattctaaccgtgctttg |
37425974 |
T |
|
| Q |
101 |
gaaatctcttcccttcccaggctacctgcaaactaacacttggtctctttcgatatgtttctaggagctgcttcatttctgtttaccaagtacgtataag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425973 |
gaaatctcttcccttcccaggctacctgcaaactaacacttggtctctttcgatatgtttctaggagctgcttcatttctgtttaccaagtacgtataag |
37425874 |
T |
|
| Q |
201 |
tacatggctatcttcgtgggtgtatttggtgcaataattttcctctttctgggctcatgaatggcttggtgctcatgctaatgccatctttagtactgtt |
300 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425873 |
tacatgactatcttcatgggtgtatttggtgcaataattttcctctttctgggctcatgaatggcttggtgctcatgctaatgccatctttagtactgtt |
37425774 |
T |
|
| Q |
301 |
tcccgtttcccttctggcttggtgctctaacctctatcccttcaggcttctgttgttgctttttgctttggtgcagtgatgggctttcttcttgctgcaa |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425773 |
tcccgtttcccttctggcttggtgctctaacctctatcccttcaggcttctgttgttgctttttgctttggtgcagtgatgggctttcttcttgctgcaa |
37425674 |
T |
|
| Q |
401 |
atggcatgttggtactatctttgattcccatatcaatcacaaggaccttgtcgcagaaattatccgactatgaaaccagtaaaatacctaaattt |
495 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425673 |
atggcatgttggtactatctttgattcccatatcaatcacgaggaccttgtcgcagaaattatccgactatgaaaccagtaaaatacctaaattt |
37425579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 347 - 492
Target Start/End: Complemental strand, 37428226 - 37428081
Alignment:
| Q |
347 |
cttctgttgttgctttttgctttggtgcagtgatgggctttcttcttgctgcaaatggcatgttggtactatctttgattcccatatcaatcacaaggac |
446 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||| ||||||||||||||||||||||||| |||| | ||||||||||||||||||||||| || |||| |
|
|
| T |
37428226 |
cttctgctgttgcttttcgctctggtgcagtgaagggctttcttcttgctgcaaatggcctgttattgctatctttgattcccatatcaattacctggac |
37428127 |
T |
|
| Q |
447 |
cttgtcgcagaaattatccgactatgaaaccagtaaaatacctaaa |
492 |
Q |
| |
|
| | |||| ||||||||||||| ||||||| |||||||||||| |
|
|
| T |
37428126 |
tgtatgacagatattatccgactataaaaccagcaaaatacctaaa |
37428081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 344 - 402
Target Start/End: Complemental strand, 37433255 - 37433197
Alignment:
| Q |
344 |
aggcttctgttgttgctttttgctttggtgcagtgatgggctttcttcttgctgcaaat |
402 |
Q |
| |
|
||||||| | |||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
37433255 |
aggcttccgctgttgcttttccctctggtgcagtgatgggctttcttcttgctgcaaat |
37433197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University