View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4090_low_3 (Length: 271)
Name: NF4090_low_3
Description: NF4090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4090_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 4682204 - 4682441
Alignment:
| Q |
19 |
atataaggggtgcgatgcatcggtacttttggacagtgttgagggaatgacaagtgagaaacaagctggaccaaatgtgaactctttacgtggatttgaa |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4682204 |
atataaggggtgtgatgcatcggtacttttggacagtgttgagggaatgacaagtgagaaacaagctggaccaaatgtgaactctttacgtggatttgaa |
4682303 |
T |
 |
| Q |
119 |
gtcattgacaagataaagtatttacttgaagaggaatgtcctctcactgtttcatgtgctgatattcttgctatggttgctcgtgatgctgttgaattgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4682304 |
gtcattgacaagataaagtatttacttgaaaaggaatgtcctctcactgtttcatgtgctgatattcttgctatggttgctcgtgatgctgttgaattgg |
4682403 |
T |
 |
| Q |
219 |
tactcatctcagccttttctctctagtctttccctttg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4682404 |
tactcatctcagccttttctctctagtctttctctttg |
4682441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 192
Target Start/End: Original strand, 11104221 - 11104269
Alignment:
| Q |
144 |
ttgaagaggaatgtcctctcactgtttcatgtgctgatattcttgctat |
192 |
Q |
| |
|
||||||| ||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
11104221 |
ttgaagaagaatgtcctaacactgtttcttgtgctgatattcttactat |
11104269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University