View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4090_low_9 (Length: 203)

Name: NF4090_low_9
Description: NF4090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4090_low_9
NF4090_low_9
[»] chr3 (1 HSPs)
chr3 (24-154)||(34574198-34574331)


Alignment Details
Target: chr3 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 24 - 154
Target Start/End: Original strand, 34574198 - 34574331
Alignment:
24 ggacaaaatagaacgtggaatttgggtaagtgaaagctagtttgtcaccactctaagatatcatttttgtgactc---atatatcataatgatttacgtt 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||   ||||||||||||||||||||||    
34574198 ggacaaaatagaacgtggaatttgggtaagtgaaagctagtttgtcattactctaagatatcatttttgtgactcataatatatcataatgatttacgtt 34574297  T
121 gtgactcaacttttgcttagaaaaagtttgtttt 154  Q
    ||||||||||||||||||||||||||||||||||    
34574298 gtgactcaacttttgcttagaaaaagtttgtttt 34574331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University