View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4091_high_11 (Length: 421)
Name: NF4091_high_11
Description: NF4091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4091_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 8e-68; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 149 - 354
Target Start/End: Complemental strand, 7896764 - 7896559
Alignment:
| Q |
149 |
gactattgtaaatatggattatgtactcttaaatctttgtagaactcaatgaagcttgaagtttattatatttttgttgttgttcaacctcttataattt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||| || ||| |
|
|
| T |
7896764 |
gactattgtaaatatggattatgtactcttaaatctttgtagaactcaatgaagcttgaagcttattatatttttgttcttgttaaacctcttttacttt |
7896665 |
T |
|
| Q |
249 |
taaacgatattaaagttacttcttgaaaatggc-ttcttgctaggagaaaggggggtctttgtatattgtatgaatggttttcgaaccctcttatttgtc |
347 |
Q |
| |
|
|||||||||||||||| ||||| | | |||||| || ||||||||||||| |||||||||||||||| || |||||||||||||||||||| || |||| |
|
|
| T |
7896664 |
taaacgatattaaagtcacttcataagaatggcttttttgctaggagaaa-tggggtctttgtatattttaagaatggttttcgaaccctctcatgtgtc |
7896566 |
T |
|
| Q |
348 |
ttcttta |
354 |
Q |
| |
|
||||||| |
|
|
| T |
7896565 |
ttcttta |
7896559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 7896904 - 7896806
Alignment:
| Q |
1 |
agcatattgagccaatgcttcatgagattctgaggatgtaaaggagtagcaagaaagtcataagcagagtgtttgtaaattgtatatatatgactttgg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896904 |
agcatattgagccaatgcttcatgagattctgagggtgtaaaggagtagcaagaaagtcataagcagagtgtttgtaaattgtatatatatgactttgg |
7896806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 276 - 411
Target Start/End: Complemental strand, 7896474 - 7896339
Alignment:
| Q |
276 |
aatggcttcttgctaggagaaaggggggtctttgtatattgtatgaatggttttcgaaccctcttatttgtcttctttactagaaagtacgtagttttag |
375 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
7896474 |
aatggctttttgctaggagaaagggggatctttgtatattgtatttatggttttcgaaccctcttatttgtcttctttactaaaaagtacgtaattttag |
7896375 |
T |
|
| Q |
376 |
gatcttgatgcgtcgaataccccttgtacctctctg |
411 |
Q |
| |
|
||||||||| ||| |||||||||| ||| |||||| |
|
|
| T |
7896374 |
tatcttgatgggtcaaataccccttatacttctctg |
7896339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University