View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4091_high_43 (Length: 251)
Name: NF4091_high_43
Description: NF4091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4091_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 97 - 237
Target Start/End: Complemental strand, 5836155 - 5836016
Alignment:
| Q |
97 |
gaaagggttgaaattggtggcactagttgaaaattcatttatgtaaatctcaaattaatccaattcaagatattgagcctcttgaattggtaccgaggaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
5836155 |
gaaagggttgaaattggtggcactagttgaaaattcatttatgtaaatctcaaattaatccaattcaagatcttgagcctcatgaattggtactgaggaa |
5836056 |
T |
 |
| Q |
197 |
gggagaaattattattacttaaaagtgaaaataatggtcat |
237 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||| |
|
|
| T |
5836055 |
gggagaaattattattactt-aaagtgaaagtaattgtcat |
5836016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University