View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4091_high_7 (Length: 449)
Name: NF4091_high_7
Description: NF4091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4091_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 4e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 34893450 - 34893286
Alignment:
| Q |
1 |
ttcttggtttccaactagatttcattctactgttgttactatgtcttaatgatctagattgttaataaggtttgaattattaagattttcattctatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34893450 |
ttcttggtttccaactagatttcattctactgttgttactatgtcttaatgatctagattgttaataaggtttgaatgattaagattttcattctatatt |
34893351 |
T |
 |
| Q |
101 |
ttgtcgaattttataagtgtttacagtgatttttggttaactatgaagtgtgtcaaaccaatcac |
165 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
34893350 |
ttatcgaattttattagtgtttacagtgatttttggttaactataaagtgtgtcaaacctatcac |
34893286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 118 - 160
Target Start/End: Original strand, 31763600 - 31763642
Alignment:
| Q |
118 |
tgtttacagtgatttttggttaactatgaagtgtgtcaaacca |
160 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
31763600 |
tgtttgcagtgatttttggttaattatgaagtgtgccaaacca |
31763642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University