View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4091_high_9 (Length: 433)
Name: NF4091_high_9
Description: NF4091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4091_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 203 - 424
Target Start/End: Complemental strand, 39139211 - 39138990
Alignment:
| Q |
203 |
ttggtagtgagcagcgagcagcaagaggttcaaagatggtgggtcttgtgagcagagcagagagcactatgaaaagagaacacaagtgtggctcgttgct |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39139211 |
ttggtagtgagcagcgagcagcaagaggttcaaagatggtgggtcttgtgagcagagcagagagcactatgaaaagagaacacaagtgtggctcgttgct |
39139112 |
T |
 |
| Q |
303 |
caacaaccacctttaattcttgatgtgctaggtaaattaatgcacattcatgtacactattacacacccagcttctttacttcacttcacatctgtttta |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39139111 |
caacaaccacctttaattcttgatgtgctaggtaaattaatgcacattcatgtacactattacacacccagcttctttacttcacttcacatctgtttta |
39139012 |
T |
 |
| Q |
403 |
tcatcatcatcatcccctatgc |
424 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
39139011 |
tcatcatcatcatcacctatgc |
39138990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 19 - 134
Target Start/End: Complemental strand, 39139395 - 39139280
Alignment:
| Q |
19 |
caaggtagtactatccaataaacaacatattaaaaacattgaaatttaaacttataagagaagaaaatactagtacatctgaagtgccaggagctctata |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
39139395 |
caaggtagtactatccaataaataacatattaaaaacattgaaatttaaacttataagagaagaaaatactagtacatctgaagtgcaaggacctctata |
39139296 |
T |
 |
| Q |
119 |
agactagactagagat |
134 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39139295 |
agactagactagagat |
39139280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University