View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4091_low_36 (Length: 302)
Name: NF4091_low_36
Description: NF4091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4091_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 18 - 284
Target Start/End: Complemental strand, 38866494 - 38866228
Alignment:
| Q |
18 |
gaaggtattgttccagagaggaagttgttgtaagcaagatgaagatgtttgagagaagaaacattgcttagagaagaaggtattgttccagtcaagaggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
38866494 |
gaaggtattgttccagagaggaagttgttgtaagcaagatgaagatgtttgagagaagaaacattgcttagagaggaaggtattgttccagtaaagaggt |
38866395 |
T |
|
| Q |
118 |
tgttaacgagagagattgtttggagttgttggaagttgctgaaggtttgtgggatgttgccggagaagttgttgaaggagaggttgagttcttggagagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866394 |
tgttaacgagagagattgtttggagttgttggaagttgctgaaggtttgtgggatgttgccggagaagttgttgaaggagaggttgagttcttggagagg |
38866295 |
T |
|
| Q |
218 |
gaggtcggagagagtgtgagggatattgccggcgaagaggttgagggagagatcaagatggcggaga |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866294 |
gaggtcggagagagtgtgagggatattgccggcgaagaggttgagggagagatcaagatggcggaga |
38866228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University