View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4091_low_4 (Length: 512)
Name: NF4091_low_4
Description: NF4091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4091_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 3e-92; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 297 - 493
Target Start/End: Original strand, 42583450 - 42583646
Alignment:
| Q |
297 |
gacagtgatgatgagaaagtttagttaagaaacaccgtacaaagatagaaaacggcttggaaacaccgtcataccatttatagcaacctcaaatcgctga |
396 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42583450 |
gacaatgatgatgagaaagtttagttaagaaacaccgtacaaagatagaaaacggcttggaaacaccgtcataccatttatagcaacctcaaatcgctga |
42583549 |
T |
|
| Q |
397 |
atcttacgtcccaactttgctttgnnnnnnnctttccttttatagtaaccacttcatttctttaactgctttcaccctttcacttcacttcggagct |
493 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42583550 |
atcttacgtcccaactttgctttgtttttttctttccttttatagtaaccacttcatttctttaactgctttcaccctttcacttcacttcggagct |
42583646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 9 - 69
Target Start/End: Original strand, 42583163 - 42583223
Alignment:
| Q |
9 |
taattctattagaagtgtgctatttgaacaacaattttataacaatttatgagacaactat |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42583163 |
taattctattagaagtgtgctatttgaacaacaattttataacaatttatgcgacaactat |
42583223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 145 - 198
Target Start/End: Original strand, 42583298 - 42583351
Alignment:
| Q |
145 |
atatgaaatagaaaattatcccaaaagttatcataaaacaatcttacaaatatc |
198 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||||| |||| |||||||| |
|
|
| T |
42583298 |
atatgaaagagaaaattatcacaaaaattatcataaaacagtcttccaaatatc |
42583351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University