View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4091_low_47 (Length: 251)

Name: NF4091_low_47
Description: NF4091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4091_low_47
NF4091_low_47
[»] chr7 (1 HSPs)
chr7 (97-237)||(5836016-5836155)


Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 97 - 237
Target Start/End: Complemental strand, 5836155 - 5836016
Alignment:
97 gaaagggttgaaattggtggcactagttgaaaattcatttatgtaaatctcaaattaatccaattcaagatattgagcctcttgaattggtaccgaggaa 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||    
5836155 gaaagggttgaaattggtggcactagttgaaaattcatttatgtaaatctcaaattaatccaattcaagatcttgagcctcatgaattggtactgaggaa 5836056  T
197 gggagaaattattattacttaaaagtgaaaataatggtcat 237  Q
    |||||||||||||||||||| ||||||||| |||| |||||    
5836055 gggagaaattattattactt-aaagtgaaagtaattgtcat 5836016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University