View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4091_low_7 (Length: 471)
Name: NF4091_low_7
Description: NF4091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4091_low_7 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
| [»] scaffold0717 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 422; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 18 - 471
Target Start/End: Original strand, 40011520 - 40011973
Alignment:
| Q |
18 |
actttcaggaactcaaacatgagtacaaacaatttacacaaaatttggaggaaaatgaaggagggaataaaggtttgtgtttgattgggaagccatggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011520 |
actttcaggaactcaaacatgagtacaaacaatttacacaaaatttggaggaaaatcaaggagggaataaaggtttgtgtttgattgggaagccatggga |
40011619 |
T |
|
| Q |
118 |
aggggttgaaaaagttgattttttggagagatttaaggtgaattatgagcacagaggagacaaacttaagagggagagtttgattgagttgaaggaaatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011620 |
aggggttgaaaaagttgattttttggagagaattaaggtgaattatgagcacagaggagagaaacttaagagggagagtttgattgagttgaaggaaatg |
40011719 |
T |
|
| Q |
218 |
tttcgtgagagaaaaatggatgaattgaaatgggtttttgaggatgatattgaaattaacgaggtttggttcgatgaaaataacaatgggaaaaggaaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011720 |
tttcgtgagagaaaaatggatgaattgaaatgggtttttgaggatgatattgaaattaacgaggtttggttcgatgaaaataacaatgggaaaaggaaaa |
40011819 |
T |
|
| Q |
318 |
agacgagtaagcgaagtgaggttcaggttgtgaggtttcttgttgataggtttgcgttctgtttttcatttgctgtcaattcttttgggagttagttagt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011820 |
agacgagtaagcgaagtgaggttcaggttgtgaggtttcttgttgataggtttgtgttctgtttttcatttgctgtcaattcttttgggagttagttaga |
40011919 |
T |
|
| Q |
418 |
atgcattgctggtgtaatattattttacatattcatccaatgacgtattgtcat |
471 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40011920 |
atgcattgttggtgtaaaattattttacacattcatccaatgacgtattgtcat |
40011973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 2847702 - 2847746
Alignment:
| Q |
18 |
actttcaggaactcaaacatgagtacaaacaatttacacaaaatt |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2847702 |
actttcaggaactcaaacatgagtacaaacaatttacacaaaatt |
2847746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0717 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0717
Description:
Target: scaffold0717; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 6934 - 6978
Alignment:
| Q |
18 |
actttcaggaactcaaacatgagtacaaacaatttacacaaaatt |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6934 |
actttcaggaactcaaacatgagtacaaacaatttacacaaaatt |
6978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University