View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4092_high_1 (Length: 305)

Name: NF4092_high_1
Description: NF4092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4092_high_1
NF4092_high_1
[»] chr2 (3 HSPs)
chr2 (182-297)||(11522857-11522972)
chr2 (18-76)||(11523077-11523135)
chr2 (17-50)||(11523035-11523068)


Alignment Details
Target: chr2 (Bit Score: 104; Significance: 7e-52; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 11522972 - 11522857
Alignment:
182 ggagagatgaatatagattcttttaccattttggataaagtttgggtatttaggggagcggttagaaaagctgtgttgggacttcagattatgttgacat 281  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
11522972 ggagagatgaatatagattcttataccatcttggataaagtttgggtatttagaggagcggttagaaaagctgtgttgggacttcagattatgttgacat 11522873  T
282 aggcatttgtgatgat 297  Q
    ||||||||||||||||    
11522872 aggcatttgtgatgat 11522857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 11523135 - 11523077
Alignment:
18 ttctttggatatttttgctttcaatatgcttttggatgctttggctaaggatcaaaagg 76  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11523135 ttctttggatatttttgctttcaatatgcttttggatgctttggctaaggatcaaaagg 11523077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 50
Target Start/End: Complemental strand, 11523068 - 11523035
Alignment:
17 tttctttggatatttttgctttcaatatgctttt 50  Q
    |||||||||||||||||||||| |||||||||||    
11523068 tttctttggatatttttgcttttaatatgctttt 11523035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University