View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4092_high_1 (Length: 305)
Name: NF4092_high_1
Description: NF4092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4092_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 7e-52; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 11522972 - 11522857
Alignment:
| Q |
182 |
ggagagatgaatatagattcttttaccattttggataaagtttgggtatttaggggagcggttagaaaagctgtgttgggacttcagattatgttgacat |
281 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11522972 |
ggagagatgaatatagattcttataccatcttggataaagtttgggtatttagaggagcggttagaaaagctgtgttgggacttcagattatgttgacat |
11522873 |
T |
|
| Q |
282 |
aggcatttgtgatgat |
297 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11522872 |
aggcatttgtgatgat |
11522857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 11523135 - 11523077
Alignment:
| Q |
18 |
ttctttggatatttttgctttcaatatgcttttggatgctttggctaaggatcaaaagg |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11523135 |
ttctttggatatttttgctttcaatatgcttttggatgctttggctaaggatcaaaagg |
11523077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 50
Target Start/End: Complemental strand, 11523068 - 11523035
Alignment:
| Q |
17 |
tttctttggatatttttgctttcaatatgctttt |
50 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
11523068 |
tttctttggatatttttgcttttaatatgctttt |
11523035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University