View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4093_low_12 (Length: 279)
Name: NF4093_low_12
Description: NF4093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4093_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 45828239 - 45828067
Alignment:
| Q |
1 |
ttatcttcgattaaaagatgaaccttgcttatctggtcttaaaagtaatcattttcgccattaaaagtgtcatttgtagtcgtagtagtccatagatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45828239 |
ttatcttcgattaaaagatgaactttgcttatctggtcttaaaagtaatcattttcgccattaaaagtgtcatttgtagtcgtagtagtccatagatcaa |
45828140 |
T |
 |
| Q |
101 |
tgaataatattttaaactatctgataggaacctctttgttagccaaataaatttctaacgttttctctagactt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45828139 |
tgaataatattttaaactatctgataggaacctctttgttagccaaat-aatttctaacgttttctctagactt |
45828067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Complemental strand, 45828049 - 45828019
Alignment:
| Q |
157 |
aacgttttctctagacttgaaaccgtttgtt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45828049 |
aacgttttctctagacttgaaaccgtttgtt |
45828019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University