View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4093_low_15 (Length: 216)
Name: NF4093_low_15
Description: NF4093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4093_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 31328108 - 31327924
Alignment:
| Q |
17 |
agtttcatctttcttgttatcatatttannnnnnngttctgaacaatgaagttaattagattggtttgttatgattatttcatgtattcatcttggcttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31328108 |
agtttcatctttcttgttatcatatttatttttttgttctgaacaatgaagttaattagattggtttgttttgattatttcatgtattcatcttggcttg |
31328009 |
T |
|
| Q |
117 |
ttattttgtcatagaggtttggttagcatagtaataggctcggtttggataaacaatttaactaagtgttaatagcataatctctg |
202 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31328008 |
ttattatgtcatagagg-ttagttagcatagtaataggctcagtttggataaacaatttaactaagtgttaatagcataatctctg |
31327924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 201
Target Start/End: Complemental strand, 17125818 - 17125776
Alignment:
| Q |
159 |
gtttggataaacaatttaactaagtgttaatagcataatctct |
201 |
Q |
| |
|
||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
17125818 |
gtttggataaacaattttattaagtgctaatagcataatctct |
17125776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 8423030 - 8422986
Alignment:
| Q |
154 |
gctcggtttggataaacaatttaactaagtgttaatagcataatc |
198 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
8423030 |
gctcagtttggataaacaacttaattaagtgtttatagcataatc |
8422986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University