View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094-2-Insertion-5 (Length: 503)
Name: NF4094-2-Insertion-5
Description: NF4094-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094-2-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 198 - 501
Target Start/End: Complemental strand, 9073009 - 9072707
Alignment:
| Q |
198 |
gtttatctaccttcccatcaaaccctatggaagtcctcaagatataccaaattgtctaccaagcttgcccttacatcaaattcgcacactttaccgctaa |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073009 |
gtttatctaccttcccatcaaaccctatggaagtcctcaagatataccaaattgtctaccaagcttgcccttacatcaaattcgcacactttaccgctaa |
9072910 |
T |
|
| Q |
298 |
ccatgccattttcgaggcgtttgaggcggaagagcgtgtccatgtcatcgaccttgatatccttcaaggctaccaatggcctgcattcatgcaggcattg |
397 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072909 |
ccaagccattttcgaggcgtttgaggctgaagagcgtgtccatgtcatcgaccttgatatccttcaaggctaccaatggcctgcattcatgcaggcattg |
9072810 |
T |
|
| Q |
398 |
gctgcacggcccggagggggctccgttcctcaggatcactggagtagggccgtgcatcgaatcggttagggaaaccggacgatgcttaacggaattagct |
497 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072809 |
gctgcacggcccgga-ggtgctccgttcctccggatcactggagtagggccgtgcatcgaatcagttagggaaaccggacgatgcttaacggaattagct |
9072711 |
T |
|
| Q |
498 |
catt |
501 |
Q |
| |
|
|||| |
|
|
| T |
9072710 |
catt |
9072707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 9073200 - 9073068
Alignment:
| Q |
7 |
atacatgctagcaagaaggtacctacaccagctcaatagagtagtaacaccactaggtgactccatgcaacgagtagcttcatgtttcacagaatctcta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073200 |
atacatgctagcaagaaggtacctacaccagctcaatagagtagtaacaccactaggtgactccatgcaacgagtagcttcatgtttcacagaatctcta |
9073101 |
T |
|
| Q |
107 |
agtgcaagacttgctgcaaccctaaccaccaag |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9073100 |
agtgcaagacttgctgcaaccctaaccaccaag |
9073068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University