View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094-2-Insertion-8 (Length: 210)
Name: NF4094-2-Insertion-8
Description: NF4094-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094-2-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 210
Target Start/End: Complemental strand, 49689535 - 49689333
Alignment:
| Q |
8 |
agaacaaatggatttaactgaaaaaaccgccaaataaccaacaggtactagcaactcagtggttaagaaagaacttcaaaagtatatactagcgttttgc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49689535 |
agaacaaatggatttaactgaaaaaaccgccaaataatcaacaggtactagcaactcagtggttaagaaagaacttcaaaagtatatactagcgttttgc |
49689436 |
T |
|
| Q |
108 |
atctttctaaagccaattccaatagttttggatcaaaaccctaaatggttagatgcatgatcatcacagcaccactgaacacatacctaacatttgcctc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49689435 |
atctttctaaagccaattccaatagttttggatcaaaaccctaaatggttagatgcatgatcatcacagcaccactgaacacatacctaacatttgcctc |
49689336 |
T |
|
| Q |
208 |
ttc |
210 |
Q |
| |
|
||| |
|
|
| T |
49689335 |
ttc |
49689333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University