View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_high_18 (Length: 356)
Name: NF4094_high_18
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 170 - 341
Target Start/End: Complemental strand, 24449500 - 24449333
Alignment:
| Q |
170 |
gatgagtccactcttggaccatttttcagagcttcatgttagacaaagctcaggcannnnnnnnnnnncaacttaagcattcacatcctaacacttagac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24449500 |
gatgagtccactcttggaccatttttcagagcttcatgttagacaaagctcaggcatttttattttttcaacttaagcattcacatcctaacacttagac |
24449401 |
T |
 |
| Q |
270 |
tatttttcagagatatatagaaccttgcaccttgtctttaaaacttttgagatggatctttgctcaccaatt |
341 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24449400 |
tatttttcagagata----gaaccttgcaccttgtctttaaaacttttgagatggatctttgctcaccaatt |
24449333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 24 - 74
Target Start/End: Complemental strand, 24449645 - 24449595
Alignment:
| Q |
24 |
caacttaagtggggttcttaattgggaaataaagccaaatataactcattt |
74 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
24449645 |
caacttaagtggggttcttacgtgggacataaagccaaatataactcattt |
24449595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University