View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_high_19 (Length: 352)
Name: NF4094_high_19
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 19 - 342
Target Start/End: Complemental strand, 7609106 - 7608783
Alignment:
| Q |
19 |
acccggagatcccatgagatcaatgtccggttcaggttttaaaacattgaatttggctgcattgtaagaatctaggaggagtatattgcataaggctgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7609106 |
acccggagatcccatgagatcaatgtccggttcaggttttaaaacattgaatttggctgcattgtaagaatctaggaggagtatattgcataaggctgta |
7609007 |
T |
 |
| Q |
119 |
taataggagtagctatttgactagaataatttgaaggcagtagctagcatgcatgacagaaataaggaaagaaacccatatctcacacagtgcaggcaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7609006 |
taataggagtagctatttgactagaataatttgaaggcagtagctagcatgcatgacagaaataaggaaagaaacccatatctcacacagtgcaggcaca |
7608907 |
T |
 |
| Q |
219 |
gtattttgattgtaatctaccatgggatgcttaaactccaataataacaatctggtccacaagctacatatgcacagcacagctagcaacaccaaccaac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7608906 |
gtattttgattgtaatctaccatgggatgcttaaactccaataataacaatctggtccacaagctacatatgcacagcacagctagcaacaccaaccaac |
7608807 |
T |
 |
| Q |
319 |
taccaacttttttatgagcctttg |
342 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
7608806 |
taccaacttttttatgagtctttg |
7608783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University