View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_high_31 (Length: 250)
Name: NF4094_high_31
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_high_31 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 142 - 250
Target Start/End: Original strand, 4269313 - 4269422
Alignment:
| Q |
142 |
catctatttcacctgaatcaagattttagtatcccattttaaaatctgagttt-atgttttgaaattttatgcatcattgcaattttggttctaaccaaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4269313 |
catctatttcacctgaatcaagattttagtatcccattttaaaatctgagttttatgtttagaaattttatgcatcattgcaattttggttctaaccaaa |
4269412 |
T |
 |
| Q |
241 |
tctctttttt |
250 |
Q |
| |
|
|||||||||| |
|
|
| T |
4269413 |
tctctttttt |
4269422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 9 - 106
Target Start/End: Original strand, 4269180 - 4269277
Alignment:
| Q |
9 |
gaaatgaaacagaaagagtaattatgtagattaaattttagaaattcttttactcaatgatagtaaaattttggtgttattctttcacacggtacaca |
106 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4269180 |
gaaaagaaaaagaaagagtaattatgtagattaaattttagaaattcttttactcaatgatagtaaaattttggtgttattctttcacacggtgcaca |
4269277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University